Question: How is this attachment of chromosomes to

> In a cross between a heterozygous tall pea plant and a dwarf plant, predict the ratios of the offspring’s genotypes and phenotypes.

> Based on genes in pea plants that we have considered in this chapter, which statement(s) is/are not correct? A. The gene causing tall plants is an allele of the gene causing dwarf plants. B. The gene causing tall plants is an allele of the gene causing

> In your own words, describe Mendel’s law of segregation. Do not use the word segregation in your answer.

> How can you determine whether an organism is heterozygous or homozygous for a dominant trait?

> With regard to genotypes, what is a true-breeding organism?

> Let’s suppose a pea plant is heterozygous for three genes, Tt Yy Rr, and each gene is on a different chromosome. How many different ways could the three pairs of homologous chromosomes line up during metaphase of meiosis I?

> A true-breeding plant with round and green seeds was crossed to a true-breeding plant with wrinkled and yellow seeds. The F1 plants were allowed to self-fertilize. What is the probability of obtaining the following plants in the F2 generation: two that h

> A pea plant that is dwarf with green, wrinkled seeds was crossed to a true-breeding plant that is tall with yellow, round seeds. The F1 generation was allowed to self-fertilize. What types of gametes, and in what proportions, would the F1 generation make

> Describe the difference between genotype and phenotype. Give three examples. Is it possible for two individuals to have the same phenotype but different genotypes?

> Honeybees are unusual in that male bees (drones) have only one copy of each gene, but female bees have two copies of their genes. This difference arises because drones develop from eggs that have not been fertilized by sperm cells. In bees, the trait of

> On rare occasions, an organism may have three copies of a chromosome and therefore has three copies of the genes on that chromosome (instead of the usual number of two copies). For such a rare organism, the alleles for each gene usually segregate so that

> What are the expected phenotypic ratios from the following cross: Tt Rr yy Aa × Tt rr YY Aa, where T = tall, t = dwarf, R = round, r = wrinkled, Y = yellow, y = green, A = axial, a = terminal; T, R, Y, and A are dominant alleles. Note: Consider using the

> A true-breeding tall pea plant was crossed to a true-breeding dwarf plant. What is the probability that an F1 individual will be truebreeding? What is the probability that an F1 individual will be a true-breeding tall plant?

> A true-breeding pea plant with round and green seeds was crossed to a true-breeding plant with wrinkled and yellow seeds. Round and yellow seeds are the dominant traits. The F1 plants were allowed to self-fertilize. What are the following probabilities f

> Marfan syndrome is a rare inherited human disorder characterized by unusually long limbs and digits plus defects in the heart (especially the aorta) and the eyes, among other symptoms. Following is a pedigree for this disorder. Affected individuals are s

> In people with maple syrup urine disease, the body is unable to metabolize the amino acids leucine, isoleucine, and valine. One of the symptoms is that the urine smells like maple syrup. An unaffected couple produced six children in the following order:

> At which stage do homologous chromosomes separate from each other?

> An individual has the genotype Aa Bb Cc and makes an abnormal gamete with the genotype AaBc. Does this gamete violate the law of independent assortment or the law of segregation (or both)? Explain your answer.

> For pea plants with the following genotypes, list the possible gametes that the plant can make: A. TT Yy Rr C. Tt Yy Rr B. Tt YY rr D. tt Yy rr

> A true-breeding tall plant was crossed to a dwarf plant. Tallness is a dominant trait. The F1 individuals were allowed to self-fertilize. What are the following probabilities for the F2 generation? A. The first plant is dwarf. B. The first plant is dwa

> What is the difference between cross-fertilization and self-fertilization?

> Albinism, a condition characterized by a partial or total lack of skin pigment, is a recessive human trait. If a phenotypically unaffected couple produce an albino child, what is the probability that their next child will be albino?

> In humans, the allele for brown eye color (B) is dominant to that for blue eye color (b). If two heterozygous parents produce children, what are the following probabilities? A. The first two children have blue eyes. B. A total of four children, two with

> A cross was made between a white male dog and two different black females. The first female gave birth to eight black pups, and the second female gave birth to four white and three black pups. What are the likely genotypes of the male parent and the two

> In cocker spaniels, solid coat color is dominant over spotted coat color. If two heterozygous dogs were crossed to each other, what would be the probability of the following combinations of offspring? A. A litter of five pups, four with solid fur and on

> Identical twins are produced from the same sperm and egg (which splits after the first mitotic division), whereas fraternal twins are produced from separate sperm and separate egg cells. If two parents with brown eyes (a dominant trait) produce one twin

> Ectrodactyly, also known as “lobster claw syndrome,” is a recessive disorder in humans. If a phenotypically unaffected couple produces an affected offspring, what are the following probabilities? A. Both parents are heterozygotes. B. An offspring is a

> Are all of the cell nuclei in the embryo sac haploid or is just the egg haploid?

> For the following pedigrees, describe what you think is the most likely inheritance pattern (dominant versus recessive). Explain your reasoning. Filled (black) symbols indicate affected individuals. I-1 I-2 II-1 II-2 II-3 II-4 II-5 III-1 III-2 III-3

> Describe the significance of nonparentals with regard to the law of independent assortment. In other words, explain how the appearance of nonparentals refutes a linkage hypothesis.

> A pea plant that is heterozygous with regard to seed color (yellow is dominant to green) is allowed to self-fertilize. What are the predicted outcomes of genotypes and phenotypes of the offspring?

> A cross is made between a pea plant that has constricted pods (a recessive trait; smooth is dominant) and is heterozygous for seed color (yellow is dominant to green) and a plant that is heterozygous for both pod texture and seed color. Construct a Punne

> Why did Mendel’s work refute the idea of blending inheritance?

> What is meant by the term diploid? Which cells of the human body are diploid, and which cells are not?

> Your textbook describes how the detrimental symptoms associated with the disease phenylketonuria (PKU) are caused by a faulty gene. Even so, a change in diet can prevent these symptoms. Pick a trait in your favorite plant and explain how genetics and the

> What is the cause of Down syndrome?

> What is meant by the term genetic variation? Give two examples of genetic variation not discussed in Chapter 1. What causes genetic variation at the molecular level?

> A human gene called the β-globin gene encodes a polypeptide that functions as a subunit of the protein known as hemoglobin. Hemoglobin is found within red blood cells; it carries oxygen. In human populations, the β-globin gene can be found as the common

> What are polar bodies?

> Briefly explain how gene expression occurs at the molecular level.

> Male honeybees, which are haploid, produce sperm by meiosis. Explain what unusual event (compared with other animals) must occur during spermatogenesis in honeybees to produce sperm. Does this unusual event occur during meiosis I or meiosis II?

> Table 8.1 shows that Turner syndrome occurs when an individual inherits one X chromosome but lacks a second sex chromosome. Can Turner syndrome be due to nondisjunction during oogenesis, spermatogenesis, or both? If a phenotypically normal couple has a c

> Meiotic nondisjunction usually occurs during meiosis I. What is not separating properly: bivalents or sister chromatids? What is not separating properly during mitotic nondisjunction?

> What is an allodiploid? What factor determines the fertility of an allodiploid? Why are allotetraploids more likely than allodiploids to be fertile?

> After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief moment occurs before the two exons are connected to each other. Which snRNP(s) hold(s) the exons in place so they can be covalently connected to each othe

> Explain what is meant by the coupling of transcription and translation in bacteria. Does coupling occur in bacterial and/or eukaryotic cells? Explain.

> An mRNA encodes a polypeptide that is 312 amino acids in length. The 53rd codon in this polypeptide is a tryptophan codon. A mutation in the gene that encodes this polypeptide changes this tryptophan codon into a stop codon. How many amino acids would be

> Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus to the carboxyl-terminus. Are the following questions a

> Referring to Figure 13.17, explain why the ribosome translocates along the mRNA in the 5′ to 3′ direction rather than the 3′ to 5′ direction. From Figure 13.17: Ribosome a E sit

> What is a polysome?

> In which of the ribosomal sites, the A site, P site, and/or E site, could the following be found? A. A tRNA without an amino acid attached B. A tRNA with a polypeptide attached C. A tRNA with a single amino acid attached

> What is the function of the nucleolus?

> Which steps during the translation of bacterial mRNA involve an interaction between complementary strands of RNA?

> An mRNA has the following sequence: 5′–AUG UAC UAU GGG GCG UAA–3′ Describe the amino acid sequence of the polypeptide that would be encoded by this mRNA. Be specific about the amino-terminus and carboxyl-terminus.

> Explain the functional roles of the A, P, and E sites during translation.

> For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GCCACCAUGG

> How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNA that provide an optimal context for a start codon.

> For each of the following initiation factors, how would eukaryotic initiation of translation be affected if it were missing? A. eIF2 B. eIF4 C. eIF5

> Describe the sequence in bacterial mRNA that promotes recognition by the 30S subunit.

> How do the four cells at the end of meiosis differ from the original mother cell?

> Which two amino acids do you think are the least soluble in water?

> What are the three stages of translation? Discuss the main events that occur during these three stages.

> Do the following events during bacterial translation occur primarily within the 30S subunit, within the 50S subunit, or at the interface between these two ribosomal subunits? A. mRNA-tRNA recognition B. Peptidyl transfer reaction C. Exit of the polype

> The term subunit can be used in a variety of ways. What is the difference between a protein subunit and a ribosomal subunit?

> Describe the components of eukaryotic ribosomal subunits and the location where the assembly of the subunits occurs within living cells.

> List the components required for translation. Describe the relative sizes of these different components. In other words, which components are small molecules, macromolecules, or assemblies of macromolecules?

> Is it necessary for a cell to make 61 different tRNA molecules, corresponding to the 61 codons for amino acids? Explain your answer.

> How and when does formylmethionine become attached to the initiator tRNA in bacteria?

> Discuss the significance of modified bases within tRNA molecules.

> What is an activated amino acid?

> What is the role of aminoacyl-tRNA synthetase? The ability of aminoacyl-tRNA synthetases to recognize tRNAs has sometimes been called the “second genetic code.” Why has the function of this type of enzyme been described this way?

> What is the end result of crossing over?

> In the tertiary structure of tRNA, where is the anticodon region relative to the attachment site for the amino acid? Are these located adjacent to each other?

> Describe the structural features that all tRNA molecules have in common.

> Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′. What type(s) of base modification to this tRNA would allow it to also recognize 5′–AAA–3′?

> If a tRNA has an anticodon sequence 3′–CCI–5′, what codon(s) can it recognize?

> A tRNA has an anticodon sequence 3′–GGU–5′. What amino acid does it carry?

> If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it could contain? Be specific about the 5′ and 3′ ends.

> How many different sequences of mRNA could encode a peptide with the sequence proline-glycine-methionine-serine?

> The wobble rules for tRNA-mRNA pairing are shown in Figure 13.12. If we assume that the tRNAs do not contain modified bases, what is the minimum number of tRNAs needed to recognize the codons for the following types of amino acids? A. Leucine B. Methio

> The covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it requires an input of energy for the reaction to proceed. Where does the energy come from to attach amino acids to tRNA molecules?

> In bacteria, researchers have isolated strains that carry mutations within tRNA genes. These mutations can change the sequence of the anticodon. For example, a normal tRNATrp gene encodes a tRNA with the anticodon 3′–ACC–5′. A mutation can change this se

> Eukaryotic cells exhibit compartmentalization. Define compartmentalization. From Figure 3.1: Microfilament Nucleolus Golgi body Nuclear Chromosomal Nucleus envelope DNA Polyribosomes Ribosome Rough endoplasmic reticulum Cytoplasm Membrane protein Pl

> According to the adaptor hypothesis, is each of the following statements true or false? A. The sequence of anticodons in tRNA directly recognizes codon sequences in mRNA, with some room for wobble. B. The amino acid attached to the tRNA directly recogn

> What does it mean when we say that the genetic code is degenerate? Discuss the universality of the genetic code

> An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA.

> What is the subunit composition of bacterial RNA polymerase holoenzyme? What are the functional roles of the different subunits?

> A mutation within a gene sequence changes the start codon to a stop codon. How will this mutation affect the transcription of this gene?

> In Chapter 9, we considered the dimensions of the double helix. In an α helix of a protein, there are 3.6 amino acids per complete turn. Each amino acid advances the α helix by 0.15 nm; a complete turn of an α he

> According to the examples shown in Figure 12.5, which positions of the −35 sequence (i.e., first, second, third, fourth, fifth, or sixth) are more tolerant of changes? Do you think these positions play a more or less important role in t

> Mutations in bacterial promoters may increase or decrease the rate of gene transcription. Promoter mutations that increase the transcription rate are termed up-promoter mutations, and those that decrease the transcription rate are termed down-promoter mu

> What is the consensus sequence of the following six DNA sequences? GGCATTGACT GCCATTGTCA CGCATAGTCA GGAAATGGGA GGCTTTGTCA GGCATAGTCA

> According to the mechanism shown in Figure 12.20, several snRNPs play different roles in the splicing of pre-mRNA. Identify the snRNP that recognizes each of the following sites: A. 5′ splice site B. 3′ splice site

> Do these examples constitute variation in chromosome structure or variation in chromosome number? From Figure 1.9: a. A person with Down syndrome. She has 47 chromosomes rather than the common number of 46, because she has an extra copy of chromosome 2

> In the splicing of group I introns shown in Figure 12.18a, does the 5′ end of the intron have a phosphate group? Explain. From Figure 12.18a: CH,OH H H он он Guanosine Guanosine- Intron binding site Exon 1 G. Exon 2 5 -3' -3 5- 3'

> The processing of ribosomal RNA in eukaryotes is shown in Figure 12.16. Why is this called cleavage or processing but not splicing? From Figure 12.16: Promoter 18S 5.8S 28S 455 FRNA Transcription primary transcript 51 18S 5.8S 28S 3' Cleavage (the l

> Figure 12.21 shows the products of alternative splicing for the α-tropomyosin pre-mRNA. Let’s suppose that smooth muscle cells produce splicing factors that are not produced in other cell types. Explain where you think suc

> What is the function of a splicing factor? Explain how splicing factors can regulate the cell-specific splicing of mRNAs.

> What is alternative splicing? What is its biological significance?

> In eukaryotes, what types of modifications occur to pre-mRNAs?