Question: As mentioned in question 2 of More

> Let’s suppose a gene exists as a functional wild-type allele and a nonfunctional mutant allele. At the organism level (i.e., at the level of visible traits), the wild-type allele is dominant. In a heterozygote, discuss whether dominance occurs at the cel

> A diploid eukaryotic cell has 10 chromosomes (5 per set). As a group, take turns having one student draw the cell as it would look during a phase of mitosis, meiosis I, or meiosis II; then have the other students guess which phase it is.

> In Figure 3.18, Morgan obtained a white-eyed male fly in a population containing many red-eyed flies that he thought were true-breeding. As mentioned in the experiment, he crossed this fly with several red-eyed females, and all the offspring had red eyes

> Consider this four-factor cross: Tt Rr yy Aa × Tt RR Yy aa, where T = tall, t = dwarf, R = round, r = wrinkled, Y = yellow, y = green, A = axial, a = terminal. What is the probability that the first three plants will have round seeds? What is the easiest

> A cross was made between two pea plants, TtAa and Ttaa, where T = tall, t = dwarf, A = axial, and a = terminal. What is the probability that the first three offspring will be tall with axial flowers or dwarf with terminal flowers and the fourth offspring

> Discuss how variation in chromosome number has been useful in agriculture.

> Which events during translation involve molecular recognition between base sequences within different RNAs? Which events involve recognition between different protein molecules?

> Discuss and make a list of the similarities and differences in the events that occur during the initiation, elongation, and termination stages of transcription (see Chapter 12) and translation discussed in this chapter.

> Why does the heterozygote have an advantage?

> Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it seem like a waste of cellular energy to make such a large structure so that translation can occur?

> Consider how histone proteins bind to DNA and then explain why a high salt concentration can remove histones from DNA (as shown in Figure 10.18b). From Figure 10.18b: 2 jum DNA strand Scaffold.

> If you were given a sample of chromosomal DNA and asked to determine if it is bacterial or eukaryotic, what experiment would you perform, and what would be your expected results?

> Researchers are often interested in focusing their attention on the transcription of protein-encoding genes in eukaryotes. Such researchers want to study mRNA. One method that is used to isolate mRNA is column chromatography. (Note: See Appendix A for a

> The technique of DNase I footprinting is described in Chapter 21. If a protein binds over a region of DNA, it will protect the DNA in that region from digestion by DNase I. To carry out a DNase I footprinting experiment, a researcher has a sample of a cl

> As described in Chapter 21 and in experimental question E3, an electrophoretic mobility shift assay can be used to determine if a protein binds to DNA. This method can also determine if a protein binds to RNA. For each of the following combinations, woul

> An electrophoretic mobility shift assay (EMSA) can be used to study the binding of proteins to a segment of DNA. This method is described in Chapter 21. When a protein binds to a segment of DNA, it slows the movement of the DNA through a gel, so the DNA

> Chapter 21 describes a technique known as Northern blotting that is used to detect RNA transcribed from a particular gene. In this method, a specific RNA is detected using a short segment of cloned DNA as a probe. The DNA probe, which is labeled, is comp

> A research group has sequenced the cDNA and genomic DNA for a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences. cDNA: 5′–ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATG

> Another technique described in Chapter 21 is polymerase chain reaction (PCR) which is based on our understanding of DNA replication. In this method, a small amount of double-stranded template DNA is mixed with a high concentration of primers. Nucleotides

> At which level is incomplete dominance more likely to be observed—at the molecular/cellular level or at the organism level?

> The technique of dideoxy sequencing of DNA is described in Chapter 21. The technique relies on the use of dideoxyribonucleotides. A dideoxyribonucleotide has a hydrogen atom attached to the 3′ carbon atom instead of a hydroxyl (−− OH) group. When a dideo

> As described in Table 11.3, what is the difference between a rapidstop and a slow-stop mutant? What are different roles of the proteins that are defective in rapid-stop and slow-stop mutants? From Figure 11.3: Examples of ts Mutants Involved in DNA

> Figure 11.4b shows an autoradiograph of a replicating bacterial chromosome. If you analyzed many replicating chromosomes, what types of information could you learn about the mechanism of DNA replication? From Figure 11.4b: FReplication fork Replicat

> An absentminded researcher follows the steps of Figure 11.3, and when the gradient is viewed under UV light, the researcher does not see any bands at all. Which of the following mistakes could account for this observation? Explain how. The researcher fo

> Answer the following questions pertaining to the experiment of Figure 11.3. A. What would be the expected results if the Meselson and Stahl experiment were carried out for four or five generations? B. What would be the expected results of the Meselson

> Let’s suppose you have isolated chromatin from some bizarre eukaryote with a linker region that is usually 300–350 bp in length. The nucleosome structure is the same as in other eukaryotes. If you digested this eukaryotic organism’s chromatin with a high

> When chromatin is treated with a salt solution of moderate concentration, the linker histone H1 is removed. A higher salt concentration removes the rest of the histone proteins. If the experiment of Figure 10.11 was carried out after the DNA was treated

> In Noll’s experiment of Figure 10.11, explain where DNase I cuts the DNA. Why were the bands on the gel in multiples of 200 bp at lower DNase I concentrations? From Figure 10.11: Experimental level Conceptual level 1. Incubate the

> We seem to know more about the structure of eukaryotic chromosomal DNA than bacterial DNA. Discuss why you think this is so, and list several experimental procedures that have yielded important information concerning the compaction of eukaryotic chromati

> Let’s suppose you have isolated DNA from a cell and viewed it under a microscope. It looks supercoiled. What experiment would you perform to determine if it is positively or negatively supercoiled? In your answer, describe your expected results. You may

> At the molecular level, what is the explanation for why the four-o’clock flowers are pink instead of red?

> Two circular DNA molecules, which we can call molecule A and molecule B, are topoisomers of each other. When viewed under the electron microscope, molecule A appears more compact than molecule B. The level of gene transcription is much lower for molecule

> Acridine orange is a chemical that inhibits the replication of F-factor DNA but does not affect the replication of chromosomal DNA, even if the chromosomal DNA contains an Hfr. Let’s suppose that you have an E. coli strain that is unable to metabolize la

> A female fruit fly has one normal X chromosome and one X chromosome with a deletion. The deletion occurred in the middle of the X chromosome and removed about 10% of the entire length of the X chromosome. Suppose you stained and observed the chromosomes

> What are G bands? Discuss how G bands are useful in the analysis of chromosome structure.

> Gierer and Schramm exposed plant tissue to purified RNA from tobacco mosaic virus, and the plants developed the same types of lesions as if they had been exposed to the virus itself. What would be the results if the RNA was treated with DNase, RNase, or

> With regard to Chargaff’s experiment described in Figure 9.10, answer the following: A. What is the purpose of paper chromatography? B. Explain why it is necessary to remove the bases in order to determine the base composition of DNA.

> The type of model building used by Pauling and by Watson and Crick involved the use of ball-and-stick units. Now we can do model building on a computer screen. Even though you may not be familiar with this approach, discuss potential advantages of using

> An interesting trait that some bacteria exhibit is resistance to being killed by antibiotics. For example, certain strains of bacteria are resistant to tetracycline, whereas other strains are sensitive to tetracycline. Describe an experiment you would ca

> With regard to the experiment described in Figure 9.2, answer the following: A. List several possible reasons why only a small percentage of the type R bacteria was converted to type S. B. Explain why an antibody was used to remove the bacteria that we

> Genetic material acts as a blueprint for an organism’s traits. Explain how Griffith’s experiments indicated that genetic material was being transferred to the type R bacteria.

> What are the two main factors that determine an organism’s traits?

> It is an exciting time to be a plant breeder because so many options are available for the development of new types of agriculturally useful plants. Let’s suppose you wish to develop a seedless tomato that can grow in a very hot climate and is resistant

> Describe the steps you would take to produce a tetraploid plant from a diploid plant.

> Describe how colchicine can be used to alter chromosome number.

> With regard to the analysis of chromosome structure, explain the experimental advantage that polytene chromosomes offer. Discuss why changes in chromosome structure are more easily detected in polytene chromosomes than in ordinary chromosomes.

> Let’s suppose a researcher conducted comparative genomic hybridization (see Figure 8.9) and accidentally added twice as much DNA from normal cells (labeled with red fluorescence) relative to DNA from cancer cells. What ratio of green-to-red fluorescence

> What is the main goal of comparative genome hybridization? Explain how the ratio of green to red fluorescence provides information about chromosome structure.

> An Hfr strain that is hisE+ and pheA+ was mixed with a strain that is hisE− and pheA−. The conjugation was interrupted and the percentage of recombinants for each gene was determined by streaking on a medium that lacke

> In your laboratory, you have an F− strain of E. coli that is resistant to streptomycin and is unable to metabolize lactose, but it can metabolize glucose. Therefore, this strain can grow on a medium that contains glucose and streptomycin, but it cannot g

> In a conjugation experiment, what is meant by the time of entry? How is the time of entry determined experimentally?

> Which individual(s) in this pedigree exhibit(s) the effect of incomplete penetrance?

> What is an interrupted mating experiment? What type of experimental information can be obtained from this type of study? Why is it necessary to interrupt mating?

> Explain how a U-tube apparatus can distinguish between genetic transfer involving conjugation and genetic transfer involving transduction. Do you think a U-tube could be used to distinguish between transduction and transformation?

> In the experiment of Figure 7.1, Lederberg and Tatum could not discern whether met+ bio+ genetic material was transferred to the met− bio− thr+ leu+ thi+ strain or if thr+ leu+ thi+ genetic material was transferred to

> In the experiment of Figure 7.1, a met− bio− thr+ leu+ thi+ cell could become met+ bio+ thr+ leu+ thi+ by a (rare) double mutation that converts the met− bio− genes into met+ bio+. L

> Two genes, designated A and B, are located 10 mu from each other. A third gene, designated C, is located 15 mu from B and 5 mu from A. The parental generation consisting of AA bb CC and aa BB cc individuals were crossed to each other. The F1 heterozygote

> Two genes are located on the same chromosome and are known to be 12 mu apart. An AABB individual was crossed to an aabb individual to produce AaBb offspring. The AaBb offspring were then testcrossed to aabb individuals. A. If the testcross produces 1000

> In Morgan’s three-factor crosses of Figure 6.3, he realized that crossing over was more frequent between the eye color and wing length genes than between the body color and eye color genes. Explain how he determined this. From Figure 6

> If two genes are more than 50 mu apart, how would you ever be able to show experimentally that they are located on the same chromosome?

> Explain why the percentage of recombinant offspring in a testcross is a more accurate measure of map distance when two genes are close together. When two genes are far apart, is the percentage of recombinant offspring an underestimate or overestimate of

> In your own words, explain why a testcross cannot produce more than 50% recombinant offspring. When a testcross does produce 50% recombinant offspring, what does this result mean?

> Does a PP individual produce more of the protein encoded by the P gene than is necessary for the purple color?

> Explain the rationale behind a testcross. Is it necessary for one of the parents to be homozygous recessive for the genes of interest? In the heterozygous parent of a testcross, must all of the dominant alleles be linked on the same chromosome and all of

> In the experiment of Figure 6.6, Stern followed the inheritance pattern in which females carried two abnormal X chromosomes to correlate genetic recombination with the physical exchange of chromosome pieces. Is it necessary to use a strain carrying two a

> Three recessive traits in garden pea plants are as follows: yellow pods are recessive to green pods, bluish green seedlings are recessive to green seedlings, creeper (a plant that cannot stand up) is recessive to normal. A true-breeding normal plant with

> A sex-influenced trait is dominant in males and causes bushy tails. The same trait is recessive in females. Fur color is not sex influenced. Yellow fur is dominant to white fur. A true-breeding female with a bushy tail and yellow fur was crossed to a whi

> In the garden pea, several different genes affect pod characteristics. A gene affecting pod color (green is dominant to yellow) is approximately 7 mu away from a gene affecting pod width (wide is dominant to narrow). Both genes are located on chromosome

> In mice, the gene that encodes the enzyme inosine triphosphatase is 12 mu from the gene that encodes the enzyme ornithine decarboxylase. Suppose you have identified a strain of mice homozygous for a defective inosine triphosphatase gene that does not pro

> A trait in garden peas involves the curling of leaves. A two-factor cross was made by crossing a plant with yellow pods and curling leaves to a wild-type plant with green pods and normal leaves. All F1 offspring had green pods and normal leaves. The F1 p

> In the tomato, three genes are linked on the same chromosome. Tall is dominant to dwarf, skin that is smooth is dominant to skin that is peachy, and fruit with a normal rounded tomato shape is dominant to oblate (flattened) shape. A plant that is true-br

> Two genes in tomatoes are 61 mu apart; normal fruit (F) is dominant to fasciated (flattened) fruit ( f ), and normal number of leaves (Lf ) is dominant to leafy (lf ). A true-breeding plant with normal leaves and fruit was crossed to a leafy plant with f

> Figure 6.1 shows the first experimental results that indicated linkage between two different genes. Conduct a chi square analysis to confirm that the genes are really linked and the data could not be explained by independent assortment. From Figure 6.1:

> Why do you think the heterozygote offspring of two Manx cats survives with developmental abnormalities, whereas the homozygote dies?

> In the experiment of Figure 5.6, why does a clone of cells produce only one type of G-6-PD enzyme? What would you expect to happen if a clone was derived from an early embryonic cell? Why does the initial sample of tissue produce both forms of G-6-PD? F

> Two male mice, which we will call male A and male B, are both phenotypically normal. Male A was from a litter that contained half phenotypically normal mice and half dwarf mice. The mother of male A was known to be homozygous for the normal Igf2 allele.

> Figure 5.6 describes the results of X-chromosome inactivation in mammals. If fast and slow alleles of glucose-6-phosphate dehydrogenase (G-6-PD) exist in other species, what would be the expected results of gel electrophoresis for a heterozygous female o

> On a camping trip, you find one male snail on a deserted island that coils to the right. However, in this same area, you find several shells (not containing living snails) that coil to the left. Therefore, you conclude that you are not certain of the gen

> You have a female snail that coils to the right, but you do not know its genotype. You may assume that right coiling (D) is dominant to left coiling (d). You also have male snails of known genotype. How would you determine the genotype of this female sna

> As a hypothetical example, a trait in mice results in abnormally long tails. You initially have a true-breeding strain with normal tails and a true-breeding strain with long tails. You then make the following types of crosses: Cross 1: When true-breedin

> Chapter 21 describes two blotting methods (i.e., Northern blotting and Western blotting) used to detect gene products. Northern blotting detects RNA and Western blotting detects proteins. Suppose that a female fruit fly is heterozygous for a maternal eff

> Describe three advantages of using pea plants as an experimental organism.

> Pick any trait you like in any species of wild plant or animal. The trait must somehow vary among different members of the species (see Figure 1.7). Note: When picking a trait to answer this question, do not pick the trait of wing color in butterflies.

> Discuss the types of experimental observations that Mary Lyon brought together in proposing her hypothesis concerning X-chromosome inactivation. In your own words, explain how these observations were consistent with her hypothesis.

> What is the molecular explanation for sex-limited inheritance?

> Many organisms are studied by geneticists. Do you think each of the following species would be more likely to be studied by a transmission geneticist, a molecular geneticist, or a population geneticist? Explain your answer. Note: More than one answer may

> Figure 1.5 shows a micrograph of chromosomes from a normal human cell. If you created this kind of image using a cell from a person with Down syndrome, what would you expect to see? From Figure 1.5: 10 20 21 22 BNG ( e PEGE 4

> The technique known as DNA sequencing (described in Chapter 21) enables researchers to determine the DNA sequence of genes. Would this technique be used primarily by transmission geneticists, molecular geneticists, or population geneticists?

> What is a genetic cross?

> A cross was made between two strains of plants that are agriculturally important. One strain was disease-resistant but herbicide-sensitive; the other strain was disease-sensitive but herbicide-resistant. A plant breeder crossed the two plants and then al

> When examining a human pedigree, what features do you look for to distinguish between X-linked recessive inheritance and autosomal recessive inheritance? How would you distinguish X-linked dominant inheritance from autosomal dominant inheritance in a hum

> Let’s suppose you were looking through a vial of fruit flies in your laboratory and noticed a male fly with pink eyes. What crosses would you make to determine if the pink allele is an X-linked gene? What crosses would you make to determine if the pink a

> As mentioned in Experimental Question E11, red eyes is the wildtype phenotype. Several different genes (with each gene existing in two or more alleles) are known to affect eye color. One allele causes purple eyes, and a different allele causes sepia eyes

> A variegated trait in plants is analyzed using reciprocal crosses. The following results are obtained: Variegated female x Normal male Normal female x Variegated male 1024 variegated + 52 normal 1113 normal + 61 variegated Explain this pattern of inh

> Chapter 21 describes a blotting method known as Northern blotting that is used to determine the amount of mRNA produced by a particular gene. In this method, the amount of a specific mRNA produced by cells is detected as a band on a gel. If one type of c

> What is the phenotype of a female cow that is heterozygous?

> Explain how the use of radiolabeled amino acids in this procedure helped to reveal the genetic code.

> Figure 5.1 describes an example of a maternal effect gene. Explain how Sturtevant deduced a maternal effect gene based on the F2 and F3 generations. From Figure 5.1: Parental generation DD d dd DD F, generation Dd Dd All dextral All sinistral F2 gen

> Summer squash exist in long, spherical, or disk shapes. When a true-breeding long-shaped strain was crossed to a true-breeding disk-shaped strain, all of the F1 offspring were disk-shaped. When the F1 offspring were allowed to self-fertilize, the F2 gene

> As shown in Figure 4.17, coat color in rodents is governed by a gene interaction. An albino rat is crossed to a black rat. The ratio of their offspring is 1 agouti : 1 black : 2 albino. What are the genotypes of the parents? From Figure 4.17: AaCc x