Which types of offspring are found in excess in the F2 generation, based on Mendel’s law of independent assortment?
> Ken Jones, an architect, organized Jones Architects on April 1, 2016. During the month, Jones Architects completed the following transactions: a. Transferred cash from a personal bank account to an account to be used for the business in exchange for comm
> The beginning inventory for Dunne Co. and data on purchases and sales for a three-month period are shown in Problem 6-1B. Problem 6-1B: The beginning inventory of merchandise at Dunne Co. and data on purchases and sales for a three-month period ending
> The following information about the payroll for the week ended December 30 was obtained from the records of Saine Co.: Tax rates assumed: Social security, 6% Medicare, 1.5% State unemployment (employer only), 5.4% Federal unemployment (employer only),
> The following transactions, adjusting entries, and closing entries were completed by Robinson Furniture Co. during a three-year period. All are related to the use of delivery equipment. The double-declining-balance method of depreciation is used. 2014 Ja
> The Gorman Group is a financial planning services firm owned and operated by Nicole Gorman. As of October 31, 2016, the end of the fiscal year, the accountant for The Gorman Group prepared an end-of-period spreadsheet, part of which follows: Instructio
> Two income statements for Cornea Company follow: a. Prepare a vertical analysis of Cornea Company’s income statements. b. Does the vertical analysis indicate a favorable or an unfavorable trend? Cornea Company Income Statements Fo
> Two income statements for Hemlock Company follow: a. Prepare a vertical analysis of Hemlock Company’s income statements. b. Does the vertical analysis indicate a favorable or an unfavorable trend? Hemlock Company Income Statements
> Lily Flower’s weekly gross earnings for the present week were $2,500. Flower has two exemptions. Using the wage bracket withholding table in Exhibit 3 with a $75 standard withholding allowance for each exemption, what is Flowerâ&#
> Tech Support Services has the following unadjusted trial balance as of January 31, 2016: The debit and credit totals are not equal as a result of the following errors: a. The cash entered on the trial balance was overstated by $8,000. b. A cash receipt
> Averill Products Inc. reported the following on the company’s income statement in 2016 and 2015: a. Determine the number of times interest charges are earned for 2016 and 2015. Round to one decimal place. b. Is the number of times int
> Berry Company reported the following on the company’s income statement in 2016 and 2015: a. Determine the number of times interest charges are earned for 2016 and 2015. Round to one decimal place. b. Is the number of times interest ch
> The Signage Company specializes in the maintenance and repair of signs, such as billboards. On March 31, 2016, the accountant for The Signage Company prepared the following trial balances: Instructions: Journalize the seven entries that adjusted the a
> Financial statement data for the years ended December 31 for Black Bull Inc. follows: a. Determine the earnings per share for 2016 and 2015. b. Does the change in the earnings per share from 2015 to 2016 indicate a favorable or an unfavorable trend?
> Financial statement data for years ending December 31 for Tango Company follows: a. Determine the inventory turnover for 2016 and 2015. b. Determine the number of days’ sales in inventory for 2016 and 2015. Use 365 days and round to o
> For the year ending April 30, 2016, Urology Medical Services Co. mistakenly omitted adjusting entries for (1) $1,400 of supplies that were used, (2) unearned revenue of $6,600 that was earned, and (3) insurance of $9,000 that expired. Indicate the combin
> Two income statements for Paragon Company follow: Prepare a horizontal analysis of Paragon Company’s income statements. Paragon Company Income Statements For Years Ended December 31 2016 2015 Fees earned $1,416,000 $1,200,000 900,
> The following data were taken from Alvarado Company’s balance sheet: a. Compute the ratio of liabilities to stockholders’ equity. b. Has the creditor’s risk increased or decreased from December 31,
> Financial statement data for the years ended December 31 for Dovetail Corporation follows: a. Determine the earnings per share for 2016 and 2015. b. Does the change in the earnings per share from 2015 to 2016 indicate a favorable or an unfavorable tren
> Pearl Corporation’s accumulated depreciation—furniture account increased by $8,400, while $3,080 of patent amortization was recognized between balance sheet dates. There were no purchases or sales of depreciable or intangible assets during the year. In a
> Rekya Mart Inc. is a general merchandise retail company that began operations on January 1, 2016. The following transactions relate to debt investments acquired by Rekya Mart Inc., which has a fiscal year ending on December 31: 2016 Apr. 1. Purchased $90
> When and in which fly or flies did crossing over occur in order to produce the F2 recombinant offspring?
> List five reasons why genetic maps are useful.
> Why are the types of offspring described in part (b) of Figure 6.5 more numerous than those described in part (c)? From Figure 6.5b: From Figure 6.5c: F, generation y y w m х х X Y F2 generation y+ y y y w w w w m m m m m m X Y х х Gray body, red e
> Why are the nonrecombinant offspring more common than the recombinant offspring?
> Of the eight possible phenotypic combinations in the F2 generation, which ones are the product of a single crossover?
> If a crossover began in the short region between gene A and the tip of the chromosome, would this event affect the arrangement of the A and B alleles?
> What is the difference between a charged tRNA and an uncharged tRNA?
> How is a nucleoid different from a cell nucleus?
> What is the difference between maintenance methylation and de novo methylation? In what cell types (somatic cells or germ-line cells) does each process occur?
> Explain why the erasure phase of imprinting is necessary in eggs.
> What would be the outcome of a cross between a heterozygous female and a male that carries two normal copies of the Igf2 gene?
> Which of the phases of XCI occurs in an adult female?
> Why do these two forms of G-6-PD migrate differently?
> At which stage of development does XCI initially occur?
> Why is the Barr body more brightly staining in a cell nucleus than the other chromosomes?
> If a mother snail is heterozygous, Dd, which gene products will the oocyte receive?
> Would this circular DNA molecule be found in an F+ or F− cell?
> With regard to studying the mechanism of conjugation, what is the purpose of using a U-tube?
> On the left side of this figure, explain why the offspring TABLE 5.2 does not have Prader-Willi syndrome but does have Angelman syndrome. From Table 5.2: Examples of Mammalian Genes That Are Imprinted* Allele Gene Expressed Function WT1 Maternal Wil
> How have chloroplasts and mitochondria changed since the initial endosymbiosis events, which occurred hundreds of millions of years ago?
> During growth, can a patch of tissue with a white phenotype give rise to a patch with a green phenotype? Explain.
> What is a reciprocal cross?
> Why do mitochondria need genes that encode rRNAs and tRNAs?
> If the recipient cell did not already have a lys− gene, could the lys+ DNA become incorporated into the bacterial chromosome? Explain.
> If these two genes were very far apart on the bacterial chromosome, how would the results have been different?
> Describe how genetic transfer can explain the growth of colonies on the middle plate.
> Does mitotic recombination occur in a gamete (sperm or egg cell) or in a somatic cell?
> How do the wobble rules affect the total number of different tRNAs that are needed to carry out translation?
> What phenomenon explains why the maximum percentage of recombinant offspring does not exceed 50%?
> DNA replication is fast, virtually error-free, and coordinated with cell division. Discuss which of these three features you think is the most important.
> Explain why all of the offspring in the F2 generation are dextral even though some of them are dd.
> Discuss the types of RNA transcripts and the functional roles they play. Why do you think some RNAs form complexes with protein subunits?
> Based on your knowledge of introns and pre-mRNA splicing, discuss whether or not you think alternative splicing fully explains the existence of introns. Can you think of other possible reasons to explain their existence?
> Compare and contrast DNA replication in bacteria and eukaryotes.
> The complementarity of its two strands is the underlying reason that DNA can be faithfully copied. Propose alternative chemical structures that could be faithfully copied.
> Discuss and make a list of the similarities and differences between bacterial and eukaryotic chromosomes.
> The prevalence of highly repetitive sequences seems rather strange to many geneticists. Do they seem strange to you? Why or why not? Discuss whether or not you think they have an important function.
> Bacterial and eukaryotic chromosomes are very compact. Discuss the advantages and disadvantages of a compact chromosomal structure.
> Cell biology textbooks often discuss cellular proteins encoded by genes that are members of a gene family. Examples of such proteins include myosins and glucose transporters. Look through a cell biology textbook and identify some proteins encoded by memb
> How might you provide evidence that DNA is the genetic material in mice?
> Try to propose structures for a genetic material that are substantially different from the double helix. Remember that the genetic material must have a way to store information and a way to be faithfully replicated.
> Which allele is an example of a loss-of-function allele?
> What are the two key functional sites of a tRNA molecule?
> Besides the ones mentioned in this textbook, look for other examples of variations in euploidy. Perhaps you might look in more advanced textbooks concerning population genetics, ecology, etc. Discuss the phenotypic consequences of these changes.
> A chromosome that was involved in a reciprocal translocation also has an inversion. In addition, the cell contains two normal chromosomes. Make a drawing that shows how these chromosomes will pair during metaphase of meiosis I. A B K M M DE D Invert
> Consider this cross in pea plants: Tt Rr yy Aa × Tt rr Yy Aa, where T = tall, t = dwarf, R = round, r = wrinkled, Y = yellow, y = green, A = axial, a = terminal. What is the expected phenotypic outcome of this cross? Have one group of students solve this
> Mendel studied seven traits in pea plants, and the garden pea happens to have seven different chromosomes. It has been pointed out that Mendel was very lucky not to have conducted crosses involving two traits governed by genes that are closely linked on
> Of the three types of genetic transfer, discuss which one(s) is/are more likely to occur between members of different species. Discuss some of the potential consequences of interspecies genetic transfer.
> Discuss the advantages of the genetic analysis of bacteria. Make a list of the types of allelic differences among bacteria that are suitable for genetic analyses.
> In Chapter 3, we discussed the idea that the X and Y chromosomes have a few genes in common. These genes are inherited in a pseudoautosomal pattern. With this phenomenon in mind, discuss whether or not the X and Y chromosomes are really distinct linkage
> In mice, a dominant allele that causes a short tail is located on chromosome 2. On chromosome 3, a recessive allele causing droopy ears is 6 mu away from another recessive allele that causes a flaky tail. A recessive allele that causes a jerker (uncoordi
> Discuss the principles of the chromosome theory of inheritance. Which principles were deduced via light microscopy, and which were deduced from crosses? What modern techniques could be used to support the chromosome theory of inheritance?
> According to the endosymbiosis theory, mitochondria and chloroplasts are derived from bacteria that took up residence within eukaryotic cells. At one time, prior to being taken up by eukaryotic cells, these bacteria were free-living organisms. However, w
> Which of these three scenarios explains overdominance with regard to the sickle cell allele? From Figure 4.8: Pathogen can successfully Pathogen cannot successfully propagate. propagate. A1A1 A1A2 Normal homozygote (sensitive to infection) Heterozyg
> Recessive maternal effect genes are identified in flies (for example) when a phenotypically normal mother cannot produce any normal offspring. Because all of the offspring are dead, this female fly cannot be used to produce a strain of heterozygous flies
> In oats, the color of the chaff is determined by a two-gene interaction. When a true-breeding black chaff plant was crossed to a true-breeding white chaff plant, the F1 generation was composed of all black chaff plants. When the F1 offspring were crossed
> Let’s suppose a gene exists as a functional wild-type allele and a nonfunctional mutant allele. At the organism level (i.e., at the level of visible traits), the wild-type allele is dominant. In a heterozygote, discuss whether dominance occurs at the cel
> A diploid eukaryotic cell has 10 chromosomes (5 per set). As a group, take turns having one student draw the cell as it would look during a phase of mitosis, meiosis I, or meiosis II; then have the other students guess which phase it is.
> In Figure 3.18, Morgan obtained a white-eyed male fly in a population containing many red-eyed flies that he thought were true-breeding. As mentioned in the experiment, he crossed this fly with several red-eyed females, and all the offspring had red eyes
> Consider this four-factor cross: Tt Rr yy Aa × Tt RR Yy aa, where T = tall, t = dwarf, R = round, r = wrinkled, Y = yellow, y = green, A = axial, a = terminal. What is the probability that the first three plants will have round seeds? What is the easiest
> A cross was made between two pea plants, TtAa and Ttaa, where T = tall, t = dwarf, A = axial, and a = terminal. What is the probability that the first three offspring will be tall with axial flowers or dwarf with terminal flowers and the fourth offspring
> Discuss how variation in chromosome number has been useful in agriculture.
> Which events during translation involve molecular recognition between base sequences within different RNAs? Which events involve recognition between different protein molecules?
> Discuss and make a list of the similarities and differences in the events that occur during the initiation, elongation, and termination stages of transcription (see Chapter 12) and translation discussed in this chapter.
> Why does the heterozygote have an advantage?
> Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it seem like a waste of cellular energy to make such a large structure so that translation can occur?
> Consider how histone proteins bind to DNA and then explain why a high salt concentration can remove histones from DNA (as shown in Figure 10.18b). From Figure 10.18b: 2 jum DNA strand Scaffold.
> If you were given a sample of chromosomal DNA and asked to determine if it is bacterial or eukaryotic, what experiment would you perform, and what would be your expected results?
> Researchers are often interested in focusing their attention on the transcription of protein-encoding genes in eukaryotes. Such researchers want to study mRNA. One method that is used to isolate mRNA is column chromatography. (Note: See Appendix A for a
> The technique of DNase I footprinting is described in Chapter 21. If a protein binds over a region of DNA, it will protect the DNA in that region from digestion by DNase I. To carry out a DNase I footprinting experiment, a researcher has a sample of a cl
> As described in Chapter 21 and in experimental question E3, an electrophoretic mobility shift assay can be used to determine if a protein binds to DNA. This method can also determine if a protein binds to RNA. For each of the following combinations, woul
> An electrophoretic mobility shift assay (EMSA) can be used to study the binding of proteins to a segment of DNA. This method is described in Chapter 21. When a protein binds to a segment of DNA, it slows the movement of the DNA through a gel, so the DNA
> Chapter 21 describes a technique known as Northern blotting that is used to detect RNA transcribed from a particular gene. In this method, a specific RNA is detected using a short segment of cloned DNA as a probe. The DNA probe, which is labeled, is comp
> A research group has sequenced the cDNA and genomic DNA for a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences. cDNA: 5′–ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATG
> Another technique described in Chapter 21 is polymerase chain reaction (PCR) which is based on our understanding of DNA replication. In this method, a small amount of double-stranded template DNA is mixed with a high concentration of primers. Nucleotides
> At which level is incomplete dominance more likely to be observed—at the molecular/cellular level or at the organism level?
> The technique of dideoxy sequencing of DNA is described in Chapter 21. The technique relies on the use of dideoxyribonucleotides. A dideoxyribonucleotide has a hydrogen atom attached to the 3′ carbon atom instead of a hydroxyl (−− OH) group. When a dideo
> As described in Table 11.3, what is the difference between a rapidstop and a slow-stop mutant? What are different roles of the proteins that are defective in rapid-stop and slow-stop mutants? From Figure 11.3: Examples of ts Mutants Involved in DNA
> Figure 11.4b shows an autoradiograph of a replicating bacterial chromosome. If you analyzed many replicating chromosomes, what types of information could you learn about the mechanism of DNA replication? From Figure 11.4b: FReplication fork Replicat
> An absentminded researcher follows the steps of Figure 11.3, and when the gradient is viewed under UV light, the researcher does not see any bands at all. Which of the following mistakes could account for this observation? Explain how. The researcher fo
